Human Variation and Race Blog

Blog Post: Human Variation and Race Blog

1. Heat is an environmental stress that impacts the survival of humans by disturbing the homeostasis stage in a pessimistic way. With heat being an environmental stress it would bring heat rashes, heat exhaustion, and heatstroke. “Heat rashes occur when the sweat glands become clogged from too much sweating or lack of circulation to the area. Heat exhaustion may occur after you’ve been exposed to high temperatures for several days and have developed dehydration. Heatstroke is caused by prolonged exposure to high temperatures or by doing physical activity in hot weather. You are considered to have a heatstroke when your body temperature reaches 104 F or higher.”

2.

·         A short term adaptation for heat is sweating. It’s the body’s natural way of trying to cool its self-down. You just need to drink lots of water or something with nutrients so that you may replenish what your body has lost and so that you don’t dehydrate or get a heat stroke while being outside or during your recreational activities.

·         A Facultative Adaptation for heat is the tone of skin. If you have dark skin you can absorb the heat, and with a lighter skin tone you can reflect the heat. For example, is when you wear something dark like black you feel warmer than when you wear something light like white.

 

·         “A developmental Adaptation for heat is bipedalism, when standing on only two legs we are less exposed from the heat of the sun, it hits less surface area on us. It also enabled our skin to have more contact with cooler and faster moving breezes.”

·         A cultural Adaptation for heat is air conditioning, which has been the greatest invention other than the heater during the winter! There’s nothing better than sitting in a cool room, when its 90-110 F outside. We have also modified our clothing to be the bare minimum when it gets hot outside.

3. The benefit of studying heat in on human variation helps us to figure out how to adapt to the environment. We figure out on ways to deal with the heat (ways to avoid it, embrace, and tolerate). We learned that we have to stay hydrated and wear objects that will protect from being harmed (hats, sunglasses, and sunscreen) but yet people still end up being exposed and harmed. We have come up with stuff like air conditioners, breathable clothing, electrolyte drinks, buildings, and swimming pools.

4. In my opinion you can’t really use race for a way of explanation for the variation of adaptation. The definition of race refers to a person’s physical characteristics, such as bone structure and skin, hair, or eye color.

Piltdown Hoax Blog Post

The Piltdown ‘human’ was found in South East England in the early 1900’s. This piece of fossil was found by a labor who then gave it to Charles Dawson, an amateur archaeologist. This piece of fossil was thought to be the first human fossil to Darwin’s theory. Dawson then met a geologist, Sir Arthur Woodward and an anatomist, Arthur Keith and Telihard.  In February 1912 Dawson published his discoveries and his thought about how it has the evidence of an ape-like jawbone and human-like teeth. This cause the scientific community in uproar. For England this was a great new, for they finally can have a proof that they also have old human-ape-like fossils found in their land. However, in 1949 they tested the fluorine content of the fossil and found out that the age of the fossil is less than 100 years old. They also found an artificial stain and the teeth had been filled on the fossil and in the end they found out that the fossil belonged to a female orangutan whose teeth had been filled so it will look like a human-like teeth. Big suspicion was given to Charles Dawson who was thought wanted to make it to the high class of scientific society. Dawson also found many other fossils with the same artificial stain found in the Piltdown’s fossil. In the end the discovery was just a Hoax. It doesn’t have an any connection between human and ape at all.

The mistake was in how competitive and deceitful England was. They wanted to prove that man’s origins came from Britain by claiming that the fossil could be the oldest human-like fossil. They also wanted to rise up even higher and wanted to use this discovery in their politics tactic too. They probably didn’t even bother to check and analyze the fossil many more times whether if it’s really a fossil that could have been the missing link to Darwin’s theory. In the end England’s mistake and arrogance brought their scientific prestige to an all-time low.

The positive aspect in this situation is that when the modern scientist was able to date the skull and developed a better technique so that they could avoid a fraud. The scientist use fluorine to determine the age of the object by timing the duration of how long the object would absorb the fluorine and chemical that were able to show the artificial stains in the skull and a more advance microscope. They also use the scientific methods to question whether if the skull could really be from and ape-human-like as well.

The human factor in the case of Piltdown Hoax should be able to be removed because at that time advance chemical and advance tests weren’t available for them and the person who conducts the experiments were conducted purely by humans alone. The human factor is much reduced in today’s science because we now have technologies that would do an experiment in the most precise measure and this reduce the error margin in science.

The life lesson from this hoax is that we should check something as important as the discovery of the first human fossil more than just with the same tests. Do all the tests that are necessary to prove that what is being said to be proven right. Also how lies and arrogance should not be involved in science because it clouds judgement. In the end truth always prevails one way or another and science is based on facts.

Analogy & Homology

Wendy N Flores

Anthro 101

Summer 2016

Blog Post: Analogy & Homology

1. For your homologus traits provide the following information (25 pts):

a. Briefly describe (NOT just identify) the two different species that possess the homologus trait. (5 pts)

My two species are a frog and a bird. A frog is an amphibian who is able to leap long distances, has a long tongue, and varies in different colors and shapes. A bird is a mammal who has the ability to fly a high distance in the air, has great eye sight to be able to hunt for food on the ground, fast in agility, and they also vary in different colors and shapes.

b. Describe the homologus trait of each species, focusing on the differences in structure and function of the trait.  Why do these homologus traits exhibit differences between the two species?  Make sure your explanation is clear and complete. (10 pts)

The homologus trait that my two species share are a common set of bones: the radius, ulna, and humerus bone. The difference in the structure of the frog is that its legs are long and (the skin that is attached to the body and leg extends and looks like a birds wing) they extend a far distance so that the frog may be able to leap across long distances so that it may be able to feed, and escape predators. The difference in the structure of the bird is that its wings give them the ability to fly, they too have the same structure like the frog but they developed it as wings. They developed wings so that they may be able to look for food and be able to escape predators in the ground. The forelimbs of these two species look very different because they have evolved differently to account for the specific lifestyles of each animal.

c. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologus trait?  (5 pts)

“The shared bones date back to a pre-historic fish that emerged onto land, eventually becoming an extinct transitional animal from which they evolved.” The reason why I believe that the ancestor possessed the homologus trait is because the fish came onto land and for it to come onto land it had to have limbs.

d. Provide an image of each species in this comparison.  (5 pts)        

2. For your analogous traits provide the following information (25 pts):

a. Briefly describe the two different species that possess the analogous trait.  (5 pts)

My two species are a platypus and a duck. Both the platypus and duck look somewhat similar. The platypus and the duck both carry and analogus trait which is that they both lay eggs even though ones a bird and the other is a mammal.

b. Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait.  Clearly explain why these analogous traits exhibit similarities between the two species.  (10 pts)

They’re both egg laying creatures with webbed feet and a rubbery snout. They look very similar because they both swim in the water, lay eggs, their nostrils are located on top of their beaks and their eyes above it, and they both extremely have the same features, but are different species.

c. All pairs of organisms share some common ancestor if you go back far enough in time.  Did the common ancestor of these two species possess this analogous trait?  Why or why not?  (5 pts)

Yes, I do believe the common ancestor of the platypus and the duck possess the analogus trait. Because even though the platypus were very poorly understood and account of the low numbers of extant species, “scientists insist that the duck billed platypus is an evolutionary link between mammals and birds.”

d. Provide an image of each species in this comparison.  (5 pts)

 \

Protein Syntehesis

TACTAAGGCAAATCTAGTGCAATGTAGAGTGAGCTTAAGTGAATC

Historical Influences on Darwin BP:2

1.       If I had to choose one person who has influenced Darwin’s theory on Natural selection it would be Thomas Malthus. Thomas wasn’t a scientist at all he was actually an economist. He did research on populations and their growth or decline. Darwin became fascinated by “the idea that the human population was growing faster than food production could sustain. This would lead to many deaths due to starvation and how the population would eventually have to level out.” This information led to Survival of the Fittest and is the cornerstone of natural selection.

2.       Thomas Malthus contribution to the scientific community was The Ecology of Human Populations. His most famous work was published in 1798 which was an essay on the Principle of Population as it affects the Future Improvement of Society.” In this paper he argued that if left unchecked, a population will outgrow its resources, leading to a host of problems. “

Links: www.study.com ; www.berkley.edu ; www.About.com

3.       Points 1-5 From How does evolution work? Have to do with Thomas Malthus work Each point describes Thomas argument on how population growth can lead into famine and catastrophe for me it looks like the great depression. Yes, I know it was done through other consequences and it’s out of the subject but the lack of food and the pictures that show us going through famine and the need of food gives us a taste on how over population could lead up too. Point one talks about how all organisms have the potential of reproducing exponentially we all agree that is true. We do have a potential of having as many kids as we would like now that we have all the technology that we didn’t have before like insemination or egg donors who can give you the blessing of having your own child because you aren’t able too. But Then Points 2-5 take place which are the questions of

·         What is preventing organisms from reproducing at their potential:

As a parent we need time, shelter, food, water, and protection.

·         Resources are limited:

Our planet has a limit of how much it could hold and produce. The more we reproduce the more land we have to build home on and the less land we have to build farms or anything that can grow us food.

·         Organisms with better access to resources will be more successful in their reproductive efforts:

Thomas had two types of checks Preventive checks: are voluntary actions people can take to avoid contributing to the population and the other one was because of his religious beliefs and that supported concept was called moral restraint: in which people resist the urge to marry and reproduce until they are capable of supporting a family. This means waiting until a larger age to marry.

·         Who gets better access to these limited resources?

The people who take their time and are blessed with money are the ones that will mostly survive because they will be able to support their family the most if it comes down to a crisis, but as human beings and in the time of age we live in who knows how this situation if it comes could play out. I honestly feel that we are able to feed the people in the world and including the ones that are lacking food because our technology is ground breaking and it is advanced enough to replicate and if it is not replicate we can mesh fruits together or something. I forgot what I read since it was so long ago all I know is that we can make a Stranaple which made my jaw drop I believe it had something to do like what we’re learning with Mendelian Genetics on how he got a paint brush and pollinated another pea plant and got different kinds of pea genetics.

4.       To be honest I believe if someone sets their mind on something they will be successful. You have to devote yourself into your work completely of course. In my opinion how does someone get inspired if not through someone’s work. Darwin was inspired through his fascination of nature and came to a conclusion, through that he started doing research came across other people’s theories and he added them or put them as examples and came up with his overall theory which was The theory of evolution by natural selection. To put my point in a clearer word’s here is someone’s else’s point of view: Charles Darwin may be known as the father of Evolution, but he was influenced heavily by many people throughout his life. Some were collaborators, some were influential Geologists, and some even from the family itself.”

5.       The church affected Darwin in a negative way in the beginning of course. During Darwin’s time the church was basically the one in power and they can either make you or break you when it came to your reputation, especially when they thought your research was blasphemous to God at that time. So Darwin had to hold back his point of view and research that he has gathered because he knew that it could tarnish his reputation in society. During his time, he couldn’t speak of to anyone because they would think he was crazy and especially with no proof. The only person he could express his ideas with was with his brother. When the time came and Darwin had everything put together he published his findings and beliefs in a book that we all know and have probably read which is known as “On The Origin of Species.”

If I Were Stranded In A Island..... What Two Things Would I Have??

If you were stranded on a desert island what two items you would take with you and why? 

This question has honestly been a popular conversation between my family and friends. Personally I have 5 items that I would have to have to survive and live comfortably, but now which two out of the five would I really take. This question has me stumped! For sure I would have to have a knife as my first item. A knife will always be one of my priorities for the fact that I need something to cut with and we all know how frustrating it is  when we cant open something with our teeth or hands and of course for protection. My second item would be a satellite phone and if that doesn't seem fair I guess a flare gun. For my chances to be seen by a passing sea vessel.