Students Study In Class And Learn From Book(s) And Are Hungry For Pizza!!!
I was worried that the last one wasn't actually pizza, and that I was just hungry for it, but I think it's right either way!! Well done, you helped me realize this assignment wasn't that complicated! Thanks :D
Wendy, everything was coded correctly. The only thing missing was the random bases at the beginning and end of your code to make your decoder look for the stop/start codons.
On that note, I notice that when you decoded another student code, you commented that those bases before the start codon and after the stop codon were there in error and added confusion to the decode. They were supposed to! That's why I asked students to include them as part of the assignment.
Here is my decode for reference:
DNA: TACTAAGGCAAATCTAGTGCAATGTAGAGTGAGCTTAAGTGAATC RNA/Codons: AUG AUU CCG UUU AGA UCA CGU UAC AUC UCA CUC GAA UUC ACU UAG (start) Students study in class and learn from book(s) and are hungry for pizza. (stop)
Hey Wendy! I think I cracked it....
ReplyDeleteStudents Study In Class And Learn From Book(s) And Are Hungry For Pizza!!!
I was worried that the last one wasn't actually pizza, and that I was just hungry for it, but I think it's right either way!! Well done, you helped me realize this assignment wasn't that complicated! Thanks :D
Perfect, and yes every word is correct. I am very happy to hear that I was of help :) hope you got pizza after our assignment!!
ReplyDeleteGood decode, Kevin.
ReplyDeleteWendy, everything was coded correctly. The only thing missing was the random bases at the beginning and end of your code to make your decoder look for the stop/start codons.
On that note, I notice that when you decoded another student code, you commented that those bases before the start codon and after the stop codon were there in error and added confusion to the decode. They were supposed to! That's why I asked students to include them as part of the assignment.
Here is my decode for reference:
DNA: TACTAAGGCAAATCTAGTGCAATGTAGAGTGAGCTTAAGTGAATC
RNA/Codons: AUG AUU CCG UUU AGA UCA CGU UAC AUC UCA CUC GAA UUC ACU UAG
(start) Students study in class and learn from book(s) and are hungry for pizza. (stop)